Быстрый заказ

Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ICAM2 Информация о продукте «Клон cDNA»
Размер кДНК:828bp
Описание кДНК:Full length Clone DNA of Homo sapiens intercellular adhesion molecule 2 (ICAM2), transcript variant 5 with C terminal Flag tag.
Синоним гена:CD102
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10332-ACGRBS15400
Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10332-ACRRBS15400
Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10332-CFRBS13340
Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10332-CHRBS13340
Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10332-CMRBS13340
Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10332-CYRBS13340
Человек ICAM-2/CD102 transcript variant 5 Джин клон кДНК в вектор клонированияHG10332-MRBS5130
Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10332-M-FRBS13340
Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10332-NFRBS13340
Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10332-NHRBS13340
Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10332-NMRBS13340
Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10332-NYRBS13340
Человек ICAM-2/CD102 transcript variant 5 Джин ORF экспрессии кДНК клона плазмидыHG10332-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Intercellular adhesion molecule 2 (ICAM-2, CD102), belongs to the ICAM family consisting of three members identified as ligands for integrin receptors. It is a type I transmembrane glycoprotein with two Ig-like C2-type domains, and binds to the leukocyte integrins LFA-1 (CD11a/CD18) and Mac-1 (CD11b/CD18). As a second ligand of leukocyte function-associated antigen-1, ICAM-2 functions as a costimulatory molecule for effector cells. ICAM-2 is mainly expressed on vascular endothelial and hematopoietic cells. Interactions of ICAM-2 and the integrin receptors mediate cell adhesion in a wide range of lymphocyte, monocyte, natural killer cell, and granulocytewith other cells, and play important roles in many adhesion-dependent immune and inflammation responses, such as T cell aggregation, NK-cell cytotoxicity and migration, lymphocyte recirculation, etc. Serum levels of ICAM-2 correlated significantly with the inflammatory and course sequences of trichinosis in mice and had a similar relation with blood eosinophilia. So, estimation of ICAM-2 serum levels may prove useful in diagnosis of trichinosis recent infections, and in monitoring the prognosis and response to treatment.

  • Weber KS, et al. (2004) Sialylation of ICAM-2 on platelets impairs adhesion of leukocytes via LFA-1 and DC-SIGN. Inflammation. 28(4): 177-88.
  • Tanaka H, et al. (2004) ICAM-2 gene therapy for peritoneal dissemination of scirrhous gastric carcinoma. Clin Cancer Res. 10(14): 4885-92.
  • Younis AI, et al. (2005) Intercellular adhesion molecule-2 (ICAM-2) in experimental trichinosis. J Egypt Soc Parasitol. 35(3): 1019-26.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.