Быстрый заказ

Text Size:AAA

Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ICAM1 Информация о продукте «Клон cDNA»
Размер кДНК:1599bp
Описание кДНК:Full length Clone DNA of Homo sapiens intercellular adhesion molecule 1 with C terminal Flag tag.
Синоним гена:BB2, CD54, P3.58
Участок рестрикции:KpnI + XbaI (6kb + 1.65kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human ICAM1 Gene Plasmid Map
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Human ICAM1 Gene Expression validated Image
Human ICAM-1 / CD54 ORF mammalian expression plasmid, C-Flag tag
[Щелкните, чтобы увеличить изображение]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10346-ACGRBS16760
Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10346-ACRRBS16760
Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10346-CFRBS14710
Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10346-CHRBS14710
Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10346-CMRBS14710
Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10346-CYRBS14710
Человек ICAM-1/CD54 Джин клон кДНК в вектор клонированияHG10346-MRBS5130
Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмидыHG10346-M-NRBS14710
Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10346-NFRBS14710
Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10346-NHRBS14710
Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10346-NMRBS14710
Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10346-NYRBS14710
Человек ICAM-1/CD54 Джин ORF экспрессии кДНК клона плазмидыHG10346-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Intercellular adhesion molecule-1 (ICAM-1, or CD54) is a 90 kDa member of the immunoglobulin (Ig) superfamily and is critical for the firm arrest and transmigration of leukocytes out of blood vessels and into tissues. ICAM-1 is constitutively present on endothelial cells, but its expression is increased by proinflammatory cytokines. The endothelial expression of ICAM-1 is increased in atherosclerotic and transplant-associated atherosclerotic tissue and in animal models of atherosclerosis. Additionally, ICAM-1 has been implicated in the progression of autoimmune diseases. ICAM-1 is a ligand for LFA-1(integrin). When activated, leukocytes bind to endothelial cells via ICAM-1/LFA-1 interaction and then transmigrate into tissues. Presence with heavy glycosylation and other structural characteristics, ICAM-1 possesses binding sites for a number of immune-associated ligands and serves as the binding site for entry of the major group of human Rhinovirus (HRV) into various cell types. ICAM-1 also becomes known for its affinity for Plasmodium falciparum-infected erythrocytes (PFIE), providing more of a role in infectious disease. Previous studies have shown that ICAM-1 is involved in inflammatory reactions and that a defect in ICAM-1 gene inhibits allergic contact hypersensitivity.

  • Xu H, et al. (2001) The role of ICAM-1 molecule in the migration of Langerhans cells in the skin and regional lymph node. Eur J Immunol. 31(10): 3085-93.
  • Terol MJ, et al. (2003) Soluble intercellular adhesion molecule-1 (s-ICAM-1/s-CD54) in diffuse large B-cell lymphoma: association with clinical characteristics and outcome. Ann Oncol. 14(3): 467-74.
  • Mendez MP, et al. (2006) Shedding of soluble ICAM-1 into the alveolar space in murine models of acute lung injury. Am J Physiol Lung Cell Mol Physiol. 290(5): L962-70.
  • Lawson C, et al. (2009) ICAM-1 signaling in endothelial cells. Pharmacol Rep. 61(1): 22-32.
  • Size / Price
    Каталог: HG10346-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human ICAM-1 / CD54 ORF mammalian expression plasmid, C-Flag tag
    • Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.