Быстрый заказ

Человек HYAL2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HYAL2 Информация о продукте «Клон cDNA»
Размер кДНК:1422bp
Описание кДНК:Full length Clone DNA of Homo sapiens hyaluronoglucosaminidase 2 with N terminal His tag.
Синоним гена:LUCA2, HYAL2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек HYAL2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек HYAL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14275-ACGRBS15400
Человек HYAL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14275-ACRRBS15400
Человек HYAL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14275-CFRBS13340
Человек HYAL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14275-CHRBS13340
Человек HYAL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14275-CMRBS13340
Человек HYAL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14275-CYRBS13340
Человек HYAL2 Джин клон кДНК в вектор клонированияHG14275-GRBS5130
Человек HYAL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14275-NFRBS13340
Человек HYAL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14275-NHRBS13340
Человек HYAL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14275-NMRBS13340
Человек HYAL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14275-NYRBS13340
Человек HYAL2 Джин ORF экспрессии кДНК клона плазмидыHG14275-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14275-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.