HVEM cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/2
Price:
Size:
Number:

HVEM cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
825 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 14(herpesvirus entry mediator) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.88kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HVEM cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HVEM cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

HVEM cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

ATAR cDNA ORF Clone, Human; CD270 cDNA ORF Clone, Human; HVEA cDNA ORF Clone, Human; HVEM cDNA ORF Clone, Human; LIGHTR cDNA ORF Clone, Human; TR2 cDNA ORF Clone, Human

HVEM Background Information

Herpesvirus entry mediator (HVEM), also referred to as TNFRSF14, TR2 (TNF receptor-like molecule) and ATAR (another TRAF-associated receptor), is a member of type I transmembrane protein belonging to the TNF-receptor superfamily. It is expressed on many immune cells, including T and B cells, NK cells, monocytes, and neutrophils. Two TNF superfamily ligands lymphotoxin α (TNF-β) and LIGHT (TNFSF14) are identified as cellular ligands for HVEM and initiate the positive signaling. However, recent studies have revealed that HVEM is also involved in the unique inhibitory signaling pathway for T cells through activating tyrosine phosphorylation of the immunoreceptor tyrosine-based inhibitory motif (ITIM) in B and T lymphocyte attenuator (BTLA). HVEM provides a stimulatory signal following engagement with LIGHT (TNFSF14) on T cells. In contrast, it can also provide an inhibitory signal to T cells when it binds the B and T lymphocyte attenuator (BTLA), a ligand member of the Immunoglobulin (Ig) superfamily. Thus, HVEM may be viewed as a molecular switch, capable of facilitating both stimulatory and inhibitory cosignaling in T cells. Substantial evidence from both human disease and from experimental mouse models has indicated that dysregulation of the LIGHT-HVEM-BTLA cosignaling pathway can cause inflammation in the lung and in mucosal tissues.
Full Name
tumor necrosis factor receptor superfamily, member 14
References
  • Murphy KM, et al. (2006) Balancing co-stimulation and inhibition with BTLA and HVEM. Nat Rev Immunol. 6(9): 671-81.
  • Heo SK, et al. (2007) HVEM signaling in monocytes is mediated by intracellular calcium mobilization. J Immunol. 179(9): 6305-10.
  • Steinberg MW, et al. (2008) A crucial role for HVEM and BTLA in preventing intestinal inflammation. J Exp Med. 205(6): 1463-76.
  • Pasero C, et al. (2009) A role for HVEM, but not lymphotoxin-beta receptor, in LIGHT-induced tumor cell death and chemokine production. Eur J Immunol. 39(9): 2502-14.
  • Cheung TC. Modulation of T cell proliferation through the LIGHT-HVEM-BTLA cosignaling pathway. Recent Pat DNA Gene Seq. 3(3): 177-82.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait