After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human HSPB8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_014365.2
Размер кДНК:591bp
Описание кДНК:Full length Clone DNA of Homo sapiens heat shock 22kDa protein 8.
Синоним гена:H11, HMN2, CMT2L, DHMN2, E2IG1, HMN2A, HSP22, HSPB8
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-HSPB8
Участок рестрикции:KpnI + XbaI (6.1kb + 0.59kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human HSPB8 Gene Plasmid Map
Human HSPB8 / Cryac Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10666-ACGRBS15400
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10666-ACRRBS15400
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10666-ANGRBS15400
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10666-ANRRBS15400
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10666-CFRBS13340
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10666-CHRBS13340
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10666-CMRBS13340
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10666-CYRBS13340
Человек HSPB8/Cryac Джин клон кДНК в вектор клонированияHG10666-MRBS5130
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10666-M-FRBS13340
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10666-NFRBS13340
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10666-NHRBS13340
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10666-NMRBS13340
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10666-NYRBS13340
Человек HSPB8/Cryac Джин ORF экспрессии кДНК клона плазмидыHG10666-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10666-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».