Быстрый заказ

Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HSPA5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005347.4
Размер кДНК:1965bp
Описание кДНК:Full length Clone DNA of Homo sapiens heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) with N terminal Flag tag.
Синоним гена:BIP, MIF2, GRP78, FLJ26106, HSPA5
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-HSPA5
Участок рестрикции:KpnI + XbaI (6kb + 2kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human HSPA5 Gene Plasmid Map
Human HSPA5 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12063-ACGRBS16760
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12063-ACRRBS16760
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12063-ANGRBS16760
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12063-ANRRBS16760
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12063-CFRBS14710
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12063-CHRBS14710
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12063-CMRBS14710
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12063-CYRBS14710
Человек HSPA5 Джин клон кДНК в вектор клонированияHG12063-GRBS5130
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12063-NFRBS14710
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12063-NHRBS14710
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12063-NMRBS14710
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12063-NYRBS14710
Человек HSPA5 Джин ORF экспрессии кДНК клона плазмидыHG12063-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12063-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human HSPA5 natural ORF mammalian expression plasmid, N-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».