GRP94 / HSP90B1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

GRP94 / HSP90B1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2451 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human heat shock protein 90kDa beta (Grp94), member 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI(three restriction sites) + XbaI(6kb+0.50kb+0.98kb+0.99kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GRP94 / HSP90B1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GRP94 / HSP90B1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

GRP94 / HSP90B1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

ECGP cDNA ORF Clone, Human; GP96 cDNA ORF Clone, Human; GRP94 cDNA ORF Clone, Human; HEL-S-125m cDNA ORF Clone, Human; HEL35 cDNA ORF Clone, Human; TRA1 cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed