After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HSP90AB1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_007355.3
Размер кДНК:2175bp
Описание кДНК:Full length Clone DNA of Homo sapiens heat shock protein 90kDa alpha (cytosolic), class B member 1 with N terminal His tag.
Синоним гена:HSPC2, HSPCB, D6S182, HSP90B, FLJ26984, HSP90-BETA, HSP90AB1
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11381-ACGRBS16764
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11381-ACRRBS16764
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11381-ANGRBS16764
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11381-ANRRBS16764
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11381-CFRBS14711
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11381-CHRBS14711
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11381-CMRBS14711
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11381-CYRBS14711
Человек HSP90/HSP90AB1 Джин клон кДНК в вектор клонированияHG11381-GRBS5132
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11381-NFRBS14711
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11381-NHRBS14710
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11381-NMRBS14710
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11381-NYRBS14711
Человек HSP90/HSP90AB1 Джин ORF экспрессии кДНК клона плазмидыHG11381-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11381-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».