After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HSP90AA1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005348.3
Размер кДНК:2199bp
Описание кДНК:Full length Clone DNA of Homo sapiens heat shock protein 90kDa alpha (cytosolic), class A member 1 with N terminal Myc tag.
Синоним гена:HSPN, LAP2, HSP86, HSPC1, HSPCA, Hsp89, Hsp90, HSP89A, HSP90A, HSP90N, HSPCAL1, HSPCAL4, FLJ31884, HSP90AA1
Виды:Human
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11445-ACGRBS16764
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11445-ACRRBS16764
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11445-ANGRBS16764
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11445-ANRRBS16764
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11445-CFRBS14711
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11445-CHRBS14711
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11445-CMRBS14711
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11445-CYRBS14711
Человек HSP90/HSP90AA1 Джин клон кДНК в вектор клонированияHG11445-GRBS5132
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11445-NFRBS14711
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11445-NHRBS14711
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11445-NMRBS14711
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11445-NYRBS14711
Человек HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмидыHG11445-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Heat shock protein 90 (90 kDa heat-shock protein, HSP90) is a molecular chaperone involved in the trafficking of proteins in the cell. It is a remarkably versatile protein involved in the stress response and in normal homoeostatic control mechanisms. HSP90 interacts with 'client proteins', including protein kinases, transcription factors and others, and either facilitates their stabilization and activation or directs them for proteasomal degradation. By this means, HSP90 displays a multifaceted ability to influence signal transduction, chromatin remodelling and epigenetic regulation, development and morphological evolution. HSP90 operates as a dimer in a conformational cycle driven by ATP binding and hydrolysis at the N-terminus. Disruption of HSP90 leads to client protein degradation and often cell death. Under stressful conditions, HSP90 stabilizes its client proteins and provides protection to the cell against cellular stressors such as in cancer cells. Especially, several oncoproteins act as HSP90 client proteins and tumor cells require higher HSP90 activity than normal cells to maintain their malignancy. For this reason, Hsp90 has emerged as a promising target for anti-cancer drug development.

Ссылки
  • Pearl LH, et al. (2008) The Hsp90 molecular chaperone: an open and shut case for treatment. Biochem J. 410(3): 439-53.
  • Hahn JS. (2009) The Hsp90 chaperone machinery: from structure to drug development. BMB Rep. 42(10): 623-30.
  • Holzbeierlein JM, et al. (2010) Hsp90: a drug target? Curr Oncol Rep. 12(2): 95-101.
  • Trepel J, et al. (2010) Targeting the dynamic HSP90 complex in cancer. Nat Rev Cancer. 10(8): 537-49.
  • Size / Price
    Каталог: HG11445-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».