Быстрый заказ

Text Size:AAA

Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HSD3B2 Информация о продукте «Клон cDNA»
Размер кДНК:1119bp
Описание кДНК:Full length Clone DNA of Homo sapiens hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 with C terminal Myc tag.
Синоним гена:HSDB, HSD3B, SDR11E2
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14744-ACGRBS15400
Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14744-ACRRBS15400
Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14744-CFRBS13340
Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14744-CHRBS13340
Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14744-CMRBS13340
Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14744-CYRBS13340
Человек HSD3B2 Джин клон кДНК в вектор клонированияHG14744-GRBS5130
Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14744-NFRBS13340
Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14744-NHRBS13340
Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14744-NMRBS13340
Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14744-NYRBS13340
Человек HSD3B2 Джин ORF экспрессии кДНК клона плазмидыHG14744-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14744-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.