Быстрый заказ

Человек HRAS Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HRAS Информация о продукте «Клон cDNA»
Размер кДНК:570bp
Описание кДНК:Full length Clone DNA of Homo sapiens v-Ha-ras Harvey rat sarcoma viral oncogene homolog with C terminal HA tag.
Участок рестрикции:KpnI + XbaI (6kb + 0.61kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human HRAS Gene Plasmid Map
Human HRAS natural ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек HRAS Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек HRAS Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12059-ACGRBS15400
Человек HRAS Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12059-ACRRBS15400
Человек HRAS Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12059-CFRBS13340
Человек HRAS Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12059-CHRBS13340
Человек HRAS Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12059-CMRBS13340
Человек HRAS Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12059-CYRBS13340
Человек HRAS Джин клон кДНК в вектор клонированияHG12059-GRBS5130
Человек HRAS Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12059-NFRBS13340
Человек HRAS Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12059-NHRBS13340
Человек HRAS Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12059-NMRBS13340
Человек HRAS Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12059-NYRBS13340
Человек HRAS Джин ORF экспрессии кДНК клона плазмидыHG12059-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

HRas, also known as HRAS, belongs to the small GTPase superfamily, Ras family and is widely expressed. It functions in signal transduction pathways. HRas can bind GTP and GDP, and they have intrinsic GTPase activity. It undergoes a continuous cycle of de- and re-palmitoylation, which regulates its rapid exchange between the plasma membrane and the Golgi apparatus. Defects in HRAS are the cause of faciocutaneoskeletal syndrome (FCSS). FCSS is arare condition characterized by prenatally increased growth, postnatal growth deficiency, mental retardation, distinctive facial appearance, cardiovascular abnormalities, tumor predisposition, skin and musculoskeletal abnormalities. Defects in HRAS also can cause congenital myopathy with excess of muscle spindles. HRAS deficiency may be a cause of susceptibility to Hurthle cell thyroid carcinoma. It has been shown that defects in HRAS can cause susceptibility to bladder cancer which is a malignancy originating in tissues of the urinary bladder. It often presents with multiple tumors appearing at different times and at different sites in the bladder. Most bladder cancers are transitional cell carcinomas. They begin in cells that normally make up the inner lining of the bladder. Other types of bladder cancer include squamous cell carcinoma (cancer that begins in thin, flat cells) and adenocarcinoma (cancer that begins in cells that make and release mucus and other fluids). Bladder cancer is a complex disorder with both genetic and environmental influences. Defects in HRAS are the cause of oral squamous cell carcinoma.

  • Schulten HJ, et al. (2011) Mutational screening of RET, HRAS, KRAS, NRAS, BRAF, AKT1, and CTNNB1 in medullary thyroid carcinoma. Anticancer Res. 31(12):4179-83.
  • Gripp KW, et al. (2011) Molecular confirmation of HRAS p.G12S in siblings with Costello syndrome. Am J Med Genet A. 155A(9):2263-8.
  • Na KY, et al. (2012) Allelic loss of susceptibility loci and the occurrence of BRAF and RAS mutations in patients with familial non-medullary thyroid cancer. J Surg Oncol. 105(1):10-4.
  • Membrino A, et al. (2011) G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy. PLoS One. 6(9):e24421.
  • Size / Price
    Каталог: HG12059-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human HRAS natural ORF mammalian expression plasmid, C-HA tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.