After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human HPRT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000194
Размер кДНК:657bp
Описание кДНК:Full length Clone DNA of Homo sapiens hypoxanthine phosphoribosyltransferase 1.
Синоним гена:HGPRT
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-HPRT1
Участок рестрикции:KpnI + XbaI (6.1kb + 0.66kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human HPRT1 Gene Plasmid Map
Human HPRT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12034-ACGRBS15400
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12034-ACRRBS15400
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12034-ANGRBS15400
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12034-ANRRBS15400
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12034-CFRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12034-CHRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12034-CMRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12034-CYRBS13340
Человек HPRT1 Джин клон кДНК в вектор клонированияHG12034-GRBS5130
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12034-NFRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12034-NHRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12034-NMRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12034-NYRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмидыHG12034-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12034-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human HPRT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».