Быстрый заказ

Text Size:AAA

Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HPRT1 Информация о продукте «Клон cDNA»
Размер кДНК:657bp
Описание кДНК:Full length Clone DNA of Homo sapiens hypoxanthine phosphoribosyltransferase 1 with C terminal His tag.
Синоним гена:HGPRT
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12034-ACGRBS15400
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12034-ACRRBS15400
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12034-ANGRBS15400
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12034-ANRRBS15400
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12034-CFRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12034-CHRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12034-CMRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12034-CYRBS13340
Человек HPRT1 Джин клон кДНК в вектор клонированияHG12034-GRBS5130
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12034-NFRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12034-NHRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12034-NMRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12034-NYRBS13340
Человек HPRT1 Джин ORF экспрессии кДНК клона плазмидыHG12034-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.