Быстрый заказ

Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек HPRT1 Информация о продукте «Клон cDNA»
    Размер кДНК:657bp
    Описание кДНК:Full length Clone DNA of Homo sapiens hypoxanthine phosphoribosyltransferase 1 with C terminal His tag.
    Синоним гена:HGPRT
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with HPRT1 qPCR primers for gene expression analysis, HP100005 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12034-ACGRBS15400
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12034-ACRRBS15400
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12034-ANGRBS15400
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12034-ANRRBS15400
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12034-CFRBS13340
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12034-CHRBS13340
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12034-CMRBS13340
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12034-CYRBS13340
    Человек HPRT1 Джин клон кДНК в вектор клонированияHG12034-GRBS5130
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12034-NFRBS13340
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12034-NHRBS13340
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12034-NMRBS13340
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12034-NYRBS13340
    Человек HPRT1 Джин ORF экспрессии кДНК клона плазмидыHG12034-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG12034-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.