Быстрый заказ

Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек HOXB13 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC007092
    Размер кДНК:855bp
    Описание кДНК:Full length Clone DNA of Homo sapiens homeobox B13.
    Синоним гена:PSGD, HOXB13
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HOXB13 qPCR primers for gene expression analysis, HP102904 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14254-ACGRBS15400
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14254-ACRRBS15400
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14254-ANGRBS15400
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14254-ANRRBS15400
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14254-CFRBS13340
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14254-CHRBS13340
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14254-CMRBS13340
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14254-CYRBS13340
    Человек HOXB13 Джин клон кДНК в вектор клонированияHG14254-GRBS5130
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14254-NFRBS13340
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14254-NHRBS13340
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14254-NMRBS13340
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14254-NYRBS13340
    Человек HOXB13 Джин ORF экспрессии кДНК клона плазмидыHG14254-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14254-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».