Быстрый заказ

Text Size:AAA

Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HOOK2 Информация о продукте «Клон cDNA»
Размер кДНК:2154bp
Описание кДНК:Full length Clone DNA of Homo sapiens hook homolog 2 (DrosophilA) with C terminal Myc tag.
Синоним гена:FLJ26218, HK2, HOOK2
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14136-ACGRBS16764
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14136-ACRRBS16764
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14136-ANGRBS16764
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14136-ANRRBS16764
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14136-CFRBS14711
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14136-CHRBS14711
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14136-CMRBS14711
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14136-CYRBS14711
Человек HOOK2 Джин клон кДНК в вектор клонированияHG14136-GRBS5132
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14136-NFRBS14711
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14136-NHRBS14711
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14136-NMRBS14711
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14136-NYRBS14711
Человек HOOK2 Джин ORF экспрессии кДНК клона плазмидыHG14136-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14136-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.