Быстрый заказ

Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HNRNPR Информация о продукте «Клон cDNA»
Размер кДНК:1911bp
Описание кДНК:Full length Clone DNA of Homo sapiens heterogeneous nuclear ribonucleoprotein R with N terminal Myc tag.
Синоним гена:FLJ25714, HNRPR, hnRNP R, hnRNP-R, HNRNPR
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14309-ACGRBS16760
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14309-ACRRBS16760
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14309-ANGRBS16760
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14309-ANRRBS16760
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14309-CFRBS14710
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14309-CHRBS14710
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14309-CMRBS14710
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14309-CYRBS14710
Человек HNRNP R / HNRNPR Джин клон кДНК в вектор клонированияHG14309-GRBS5130
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14309-NFRBS14710
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14309-NHRBS14710
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14309-NMRBS14710
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14309-NYRBS14710
Человек HNRNP R / HNRNPR Джин ORF экспрессии кДНК клона плазмидыHG14309-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

HNRNP R, also known as HNRNPR, is a RNA binding protein. HNRNP R gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). HnRNPs complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. HNRNP R has three repeats of quasi-RRM domains that bind to RNAs and also contains a nuclear localization motif.

  • Rossoll, et al. (2002) Specific interaction of Smn, the spinal muscular atrophy determining gene product, with hnRNP-R and gry-rbp/hnRNP-Q: a role for Smn in RNA processing in motor axons?. Hum Mol Genet. 11 (1):93-105.
  • Mourelatos, Z, et al. (2001) SMN interacts with a novel family of hnRNP and spliceosomal proteins. EMBO J. 20(19):5443-52.
  • Hassfeld W, et al. (1998) Molecular definition of heterogeneous nuclear ribonucleoprotein R (hnRNP R) using autoimmune antibody: immunological relationship with hnRNP P. Nucleic Acids Res. 26(2):439-45.
  • Size / Price
    Каталог: HG14309-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.