After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human HNRNPM Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000138
Размер кДНК:2193bp
Описание кДНК:Full length Clone DNA of Homo sapiens heterogeneous nuclear ribonucleoprotein M.
Синоним гена:CEAR, DKFZp547H118, HNRNPM4, HNRPM, HNRPM4, HTGR1, NAGR1, hnRNP M, HNRNPM
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14228-ACGRBS16760
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14228-ACRRBS16760
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14228-ANGRBS16760
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14228-ANRRBS16760
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14228-CFRBS14710
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14228-CHRBS14710
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14228-CMRBS14710
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14228-CYRBS14710
Человек HNRNPM Джин клон кДНК в вектор клонированияHG14228-GRBS5130
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14228-NFRBS14710
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14228-NHRBS14710
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14228-NMRBS14710
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14228-NYRBS14710
Человек HNRNPM Джин ORF экспрессии кДНК клона плазмидыHG14228-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14228-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».