Быстрый заказ

Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Человек HNRNPF Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC016736
Размер кДНК:1248bp
Описание кДНК:Full length Clone DNA of Homo sapiens heterogeneous nuclear ribonucleoprotein F.
Синоним гена:HNRPF, MGC110997, OK/SW-cl.23, mcs94-1, HNRNPF
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with HNRNPF qPCR primers for gene expression analysis, HP102918 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14268-ACGRBS15400
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14268-ACRRBS15400
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14268-ANGRBS15400
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14268-ANRRBS15400
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14268-CFRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14268-CHRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14268-CMRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14268-CYRBS13340
Человек HNRNPF Джин клон кДНК в вектор клонированияHG14268-GRBS5130
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14268-NFRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14268-NHRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14268-NMRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14268-NYRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмидыHG14268-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14268-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».