Быстрый заказ

Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек HNRNPF Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC016736
    Размер кДНК:1248bp
    Описание кДНК:Full length Clone DNA of Homo sapiens heterogeneous nuclear ribonucleoprotein F with N terminal His tag.
    Синоним гена:HNRPF, MGC110997, OK/SW-cl.23, mcs94-1, HNRNPF
    Виды:Human
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HNRNPF qPCR primers for gene expression analysis, HP102918 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14268-ACGRBS15400
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14268-ACRRBS15400
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14268-ANGRBS15400
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14268-ANRRBS15400
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14268-CFRBS13340
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14268-CHRBS13340
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14268-CMRBS13340
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14268-CYRBS13340
    Человек HNRNPF Джин клон кДНК в вектор клонированияHG14268-GRBS5130
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14268-NFRBS13340
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14268-NHRBS13340
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14268-NMRBS13340
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14268-NYRBS13340
    Человек HNRNPF Джин ORF экспрессии кДНК клона плазмидыHG14268-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14268-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».