Быстрый заказ

Text Size:AAA

Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HNRNPF Информация о продукте «Клон cDNA»
Размер кДНК:1248bp
Описание кДНК:Full length Clone DNA of Homo sapiens heterogeneous nuclear ribonucleoprotein F with N terminal His tag.
Синоним гена:HNRPF, MGC110997, OK/SW-cl.23, mcs94-1, HNRNPF
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14268-ACGRBS15400
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14268-ACRRBS15400
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14268-ANGRBS15400
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14268-ANRRBS15400
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14268-CFRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14268-CHRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14268-CMRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14268-CYRBS13340
Человек HNRNPF Джин клон кДНК в вектор клонированияHG14268-GRBS5130
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14268-NFRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14268-NHRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14268-NMRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14268-NYRBS13340
Человек HNRNPF Джин ORF экспрессии кДНК клона плазмидыHG14268-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14268-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.