After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HMMR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC108904
Размер кДНК:2178bp
Описание кДНК:Full length Clone DNA of Homo sapiens hyaluronan-mediated motility receptor (RHAMM) with N terminal His tag.
Синоним гена:CD168, IHABP, RHAMM
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
????��??????3?o?MG53720???������?o��?????o?????????��?����??���䡧?2??????�㨨���?1????������?��????????��????����騨���???
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15961-ACGRBS16760
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15961-ACRRBS16760
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15961-ANGRBS16760
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15961-ANRRBS16760
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15961-CFRBS14710
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15961-CHRBS14710
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15961-CMRBS14710
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15961-CYRBS14710
Человек HMMR/RHAMM Джин клон кДНК в вектор клонированияHG15961-GRBS5130
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15961-NFRBS14710
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15961-NHRBS14710
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15961-NMRBS14710
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15961-NYRBS14710
Человек HMMR/RHAMM Джин ORF экспрессии кДНК клона плазмидыHG15961-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15961-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».