After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human HMG20A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC021959
Размер кДНК:1044bp
Описание кДНК:Full length Clone DNA of Homo sapiens high mobility group 20A.
Синоним гена:FLJ10739, HMGX1, HMGXB1, HMG20A
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14212-ACGRBS15400
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14212-ACRRBS15400
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14212-ANGRBS15400
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14212-ANRRBS15400
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14212-CFRBS13340
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14212-CHRBS13340
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14212-CMRBS13340
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14212-CYRBS13340
Человек HMG20A Джин клон кДНК в вектор клонированияHG14212-GRBS5130
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14212-NFRBS13340
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14212-NHRBS13340
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14212-NMRBS13340
Человек HMG20A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14212-NYRBS13340
Человек HMG20A Джин ORF экспрессии кДНК клона плазмидыHG14212-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14212-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».