Быстрый заказ

Человек HLA-E Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек HLA-E Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC002578
    Размер кДНК:1077bp
    Описание кДНК:Full length Clone DNA of Homo sapiens major histocompatibility complex, class I, E with N terminal Flag tag.
    Синоним гена:MHC, QA1, EA1.2, EA2.1, HLA-6.2, HLA-E
    Виды:Human
    переносчик:pCMV3-SP-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HLA-E qPCR primers for gene expression analysis, HP102080 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек HLA-E Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Человек HLA-E Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13375-ACGRBS15400
    Человек HLA-E Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13375-ACRRBS15400
    Человек HLA-E Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13375-CFRBS13340
    Человек HLA-E Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13375-CHRBS13340
    Человек HLA-E Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13375-CMRBS13340
    Человек HLA-E Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13375-CYRBS13340
    Человек HLA-E Джин клон кДНК в вектор клонированияHG13375-GRBS5130
    Человек HLA-E Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13375-NFRBS13340
    Человек HLA-E Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13375-NHRBS13340
    Человек HLA-E Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13375-NMRBS13340
    Человек HLA-E Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13375-NYRBS13340
    Человек HLA-E Джин ORF экспрессии кДНК клона плазмидыHG13375-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».