Быстрый заказ

Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HIST2H2AC Информация о продукте «Клон cDNA»
Размер кДНК:390bp
Описание кДНК:Full length Clone DNA of Homo sapiens histone cluster 2, H2ac with N terminal HA tag.
Синоним гена:H2A, H2A/q, H2AFQ, H2A-GL101
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15213-ACGRBS15400
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15213-ACRRBS15400
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15213-ANGRBS15400
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15213-ANRRBS15400
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15213-CFRBS13340
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15213-CHRBS13340
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15213-CMRBS13340
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15213-CYRBS13340
Человек HIST2H2AC Джин клон кДНК в вектор клонированияHG15213-GRBS5130
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15213-NFRBS13340
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15213-NHRBS13340
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15213-NMRBS13340
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15213-NYRBS13340
Человек HIST2H2AC Джин ORF экспрессии кДНК клона плазмидыHG15213-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15213-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.