Быстрый заказ

Text Size:AAA

Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HIST1H3A Информация о продукте «Клон cDNA»
Размер кДНК:411bp
Описание кДНК:Full length Clone DNA of Homo sapiens histone cluster 1, H3a with N terminal Flag tag.
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11231-ACGRBS15400
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11231-ACRRBS15400
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11231-ANGRBS15400
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11231-ANRRBS15400
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11231-CFRBS13340
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11231-CHRBS13340
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11231-CMRBS13340
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11231-CYRBS13340
Человек HIST1H3A Джин клон кДНК в вектор клонированияHG11231-MRBS5130
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11231-NFRBS13340
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11231-NHRBS13340
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11231-NMRBS13340
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11231-NYRBS13340
Человек HIST1H3A Джин ORF экспрессии кДНК клона плазмидыHG11231-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Histone H3.1, also known as HIST1H3A, HIST1H3B, HIST1H3C, HIST1H3D, HIST1H3E, HIST1H3F, HIST1H3G, HIST1H3H, HIST1H3I, HIST1H3J, is a member of the histone H3 family which is a core component of nucleosome. It is expressed during S phase, then expression strongly decreases as cell division slows down during the process of differentiation. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling. Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures.

  • Lachner M, et al., 2001, Nature 410 (6824): 116-20.
  • Koessler H, et al., 2003, DNA Cell Biol. 22 (4): 233-41.
  • Macdonald N. et al., 2005, Mol. Cell 20: 199-211.
  • Hyllus D. et al., 2007, Genes Dev. 21: 3369-3380.
  • Garcia BA. et al., 2007, J. Biol. Chem. 282:7641-7655.
  • Yu L.-R. et al., 2007, J. Proteome Res. 6: 4150-4162.
  • Size / Price
    Каталог: HG11231-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.