Быстрый заказ

Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
ПаспортОбзорыСвязанные продуктыПротоколы
Человек HHLA2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC035971.1
Размер кДНК:1245bp
Описание кДНК:Full length Clone DNA of Homo sapiens HERV-H LTR-associating 2.
Синоним гена:B7H7
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-HHLA2
Участок рестрикции:KpnI + XbaI(6.1kb+1.25kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16139-ACGRBS15400
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16139-ACRRBS15400
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16139-CFRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16139-CHRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16139-CMRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16139-CYRBS13340
Человек B7H7 / HHLA2 Джин клон кДНК в вектор клонированияHG16139-GRBS5130
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16139-NFRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16139-NHRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16139-NMRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16139-NYRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмидыHG16139-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

B7H7 gene encodes a protein ligand found on the surface of monocytes. The encoded protein is thought to regulate cell-mediated immunity by binding to a receptor on T lymphocytes and inhibiting the proliferation of these cells. Alternate splicing results in multiple transcript variants.
HERV–H LTR-associating 2 (HHLA2, also called B7H7/B7-H5/B7y)has been recently discovered as the newest member of the B7 family and has 23–33% similarity in amino acid sequence with the other B7 molecules. This ligand is the only B7 family member that is found in humans but not in mice. It is constitutively expressed on the surface of human monocytes and is induced on B cells. HHLA2 binds to its putative receptor(s) on a variety of immune cells including CD4 and CD8 T cells and antigen-presenting cells. Similarly to B7-H3, both a T cell coinhibitory role as well as a costimulatory role has been reported for this ligand.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Ссылки
  • Janakiram M, Chinai JM, Fineberg S, et al. Expression, clinical significance, and receptor identification of the newest B7 family member HHLA2 protein. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015;21(10):2359-2366.
  • Size / Price
    Каталог: HG16139-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».