After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human HHLA2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC035971.1
Размер кДНК:1245bp
Описание кДНК:Full length Clone DNA of Homo sapiens HERV-H LTR-associating 2.
Синоним гена:B7H7
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16139-ACGRBS15400
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16139-ACRRBS15400
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16139-CFRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16139-CHRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16139-CMRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16139-CYRBS13340
Человек B7H7 / HHLA2 Джин клон кДНК в вектор клонированияHG16139-GRBS5130
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16139-NFRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16139-NHRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16139-NMRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16139-NYRBS13340
Человек B7H7 / HHLA2 Джин ORF экспрессии кДНК клона плазмидыHG16139-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16139-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».