Быстрый заказ

Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

  • Human HGF natural ORF mammalian expression plasmid, C-His tag
ПаспортОбзорыСвязанные продуктыПротоколы
Человек HGF Информация о продукте «Клон cDNA»
Размер кДНК:2181bp
Описание кДНК:Full length Clone DNA of Homo sapiens hepatocyte growth factor (hepapoietin A; scatter factor) with C terminal His tag.
Синоним гена:SF, HGFB, HPTA, F-TCF, HGF
Участок рестрикции:KpnI (two restriction sites) + XbaI (6kb+2.18kb+0.06kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with HGF qPCR primers for gene expression analysis, HP100491 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек HGF Gene Plasmid Map
Human HGF natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10463-ACGRBS16760
Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10463-ACRRBS16760
Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10463-CFRBS14710
Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10463-CHRBS14710
Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10463-CMRBS14710
Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10463-CYRBS14710
Человек HGF/Hepatocyte Growth Factor Джин клон кДНК в вектор клонированияHG10463-MRBS5130
Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10463-NFRBS14710
Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10463-NHRBS14710
Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10463-NMRBS14710
Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10463-NYRBS14710
Человек HGF/Hepatocyte Growth Factor Джин ORF экспрессии кДНК клона плазмидыHG10463-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Hepatocyte growth factor, also known as HGF, contains 4 kringle domains, 1 PAN domain and 1 peptidase S1 domain. It belongs to the peptidase S1 family, plasminogen subfamily. Hepatocyte growth factor is secreted by mesenchymal cellsas a single inactive polypeptide and is cleaved by serine proteases into a 69-kDa alpha-chain and 34-kDa beta-chain. A disulfide bond between the alpha and beta chains produces the active, heterodimeric molecule. Hepatocyte growth factor regulates cell growth, cell motility, and morphogenesis by activating a tyrosine kinase signaling cascade after binding to the proto-oncogenic c-Met receptor, and acts as a multi-functional cytokine on cells of mainly epithelial origin. Its ability to stimulate mitogenesis, cell motility, and matrix invasion gives it a central role in angiogenesis, tumorogenesis, and tissue regeneration. HGF is a potent mitogen for mature parenchymal hepatocyte cells, seems to be an hepatotrophic factor, and acts as growth factor for a broad spectrum of tissues and cell types. HGF has no detectable protease activity. Defects in hepatocyte growth factor are the cause of deafness autosomal recessive type 39. A form of profound prelingual sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Naldini L, et al. (1991) Scatter factor and hepatocyte growth factor are indistinguishable ligands for the MET receptor. EMBO J. 10(10):2867-78.
  • Comoglio, et al. (1993) Structure, biosynthesis and biochemical properties of the HGF receptor in normal and malignant cells. 65:131-65.
  • Hahn W, et al. (2011) Enhanced cardioprotective effects by coexpression of two isoforms of hepatocyte growth factor from naked plasmid DNA in a rat ischemic heart disease model. The Journal of Gene Medicine. 13(10):549-55.
  • Bottaro DP, et al. (1991) Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science. 251(4995):802-4.
  • Size / Price
    Каталог: HG10463-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.