HEY2 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

HEY2 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1014 bp
Description
Full length Clone DNA of Human hairy/enhancer-of-split related with YRPW motif 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HEY2 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

bHLHb32 cDNA ORF Clone, Human; CHF1 cDNA ORF Clone, Human; GRIDLOCK cDNA ORF Clone, Human; GRL cDNA ORF Clone, Human; HERP1 cDNA ORF Clone, Human; HESR2 cDNA ORF Clone, Human; HRT2 cDNA ORF Clone, Human

HEY2 Background Information

Full Name
hes-related family bHLH transcription factor with YRPW motif 2
Research Areas
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait