Быстрый заказ

Человек HEXA Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек HEXA Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_000520
    Размер кДНК:1590bp
    Описание кДНК:Full length Clone DNA of Homo sapiens hexosaminidase A (alpha polypeptide).
    Синоним гена:HEXA
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HEXA qPCR primers for gene expression analysis, HP101571 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек HEXA Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12037-ACGRBS16760
    Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12037-ACRRBS16760
    Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12037-CFRBS14710
    Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12037-CHRBS14710
    Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12037-CMRBS14710
    Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12037-CYRBS14710
    Человек HEXA Джин клон кДНК в вектор клонированияHG12037-GRBS5130
    Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12037-NFRBS14710
    Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12037-NHRBS14710
    Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12037-NMRBS14710
    Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12037-NYRBS14710
    Человек HEXA Джин ORF экспрессии кДНК клона плазмидыHG12037-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Ссылки
  • Norflus,F. et al., 1996, DNA Cell Biol. 15 (2):89-97.
  • Kaufman M., et al., 1997, Hum. Mutat. 10:295-300.
  • Tanaka A., et al., 2003, J. Hum. Genet. 48:571-574.
  • Chen R., et al., 2009, J. Proteome Res. 8:651-661.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Каталог: HG12037-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».