After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек HEXA Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human HEXA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000520
Размер кДНК:1590bp
Описание кДНК:Full length Clone DNA of Homo sapiens hexosaminidase A (alpha polypeptide).
Синоним гена:HEXA
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12037-ACGRBS16760
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12037-ACRRBS16760
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12037-CFRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12037-CHRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12037-CMRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12037-CYRBS14710
Человек HEXA Джин клон кДНК в вектор клонированияHG12037-GRBS5130
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12037-NFRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12037-NHRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12037-NMRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12037-NYRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмидыHG12037-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Norflus,F. et al., 1996, DNA Cell Biol. 15 (2):89-97.
  • Kaufman M., et al., 1997, Hum. Mutat. 10:295-300.
  • Tanaka A., et al., 2003, J. Hum. Genet. 48:571-574.
  • Chen R., et al., 2009, J. Proteome Res. 8:651-661.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Каталог: HG12037-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».