Быстрый заказ

Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HEXA Информация о продукте «Клон cDNA»
Размер кДНК:1590bp
Описание кДНК:Full length Clone DNA of Homo sapiens hexosaminidase A (alpha polypeptide) with C terminal His tag.
Синоним гена:HEXA
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12037-ACGRBS16760
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12037-ACRRBS16760
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12037-CFRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12037-CHRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12037-CMRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12037-CYRBS14710
Человек HEXA Джин клон кДНК в вектор клонированияHG12037-GRBS5130
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12037-NFRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12037-NHRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12037-NMRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12037-NYRBS14710
Человек HEXA Джин ORF экспрессии кДНК клона плазмидыHG12037-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Norflus,F. et al., 1996, DNA Cell Biol. 15 (2):89-97.
  • Kaufman M., et al., 1997, Hum. Mutat. 10:295-300.
  • Tanaka A., et al., 2003, J. Hum. Genet. 48:571-574.
  • Chen R., et al., 2009, J. Proteome Res. 8:651-661.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Каталог: HG12037-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.