After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human HBB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000518
Размер кДНК:444bp
Описание кДНК:Full length Clone DNA of Homo sapiens hemoglobin, beta.
Синоним гена:CD113t-C, HBD, beta-globin
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-HBB
Участок рестрикции:KpnI + XbaI (6.1kb + 0.44kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human HBB Gene Plasmid Map
Human HBB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12016-ACGRBS15400
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12016-ACRRBS15400
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12016-ANGRBS15400
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12016-ANRRBS15400
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12016-CFRBS13340
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12016-CHRBS13340
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12016-CMRBS13340
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12016-CYRBS13340
Человек HBB/hemoglobin-beta Джин клон кДНК в вектор клонированияHG12016-GRBS5130
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12016-NFRBS13340
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12016-NHRBS13340
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12016-NMRBS13340
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12016-NYRBS13340
Человек HBB/hemoglobin-beta Джин ORF экспрессии кДНК клона плазмидыHG12016-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12016-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human HBB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».