Быстрый заказ

Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human HAO1 Информация о продукте «Клон cDNA»
Размер кДНК:1113bp
Описание кДНК:Full length Clone DNA of Homo sapiens hydroxyacid oxidase (glycolate oxidase) 1 with C terminal HA tag.
Синоним гена:GOX, GOX1, HAOX1, MGC142225, MGC142227, HAO1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12076-ACGRBS15396
Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12076-ACRRBS15396
Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12076-ANGRBS15396
Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12076-ANRRBS15396
Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12076-CFRBS13343
Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12076-CHRBS13343
Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12076-CMRBS13343
Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12076-CYRBS13343
Человек HAO1 Джин клон кДНК в вектор клонированияHG12076-GRBS5132
Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12076-NFRBS13343
Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12076-NHRBS13343
Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12076-NMRBS13343
Человек HAO1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12076-NYRBS13343
Человек HAO1 Джин ORF экспрессии кДНК клона плазмидыHG12076-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Hydroxyacid oxidase 1, also known as Glycolate oxidase, HAO1 and GOX1, is a member of the FMN-dependent alpha-hydroxy acid dehydrogenase family. HAO1 / GOX1 has 2-hydroxyacid oxidase activity. It is most active on the 2-carbon substrate glycolate, but is also active on 2-hydroxy fatty acids, with high activity towards 2-hydroxy palmitate and 2-hydroxy octanoate. HAO1 / GOX1 is a liver-specific peroxisomal enzyme that oxidizes glycolate to glyoxylate with concomitant production of H2O2. In Hao1 messenger RNA (mRNA), an iron-responsive element (IRE) homologous to the sequence recognized by iron regulatory proteins (IRP), key regulators of iron homeostasis, is present. Mammalian HAO1 / GOX1 is a peroxisomal protein and that the C-terminal sequence SKI acts as the targeting signal. Down-regulation of HAO1 / GOX1 expression during oxidative stress may provide a mechanism to prevent excessive H2O2 formation in liver peroxisomes and may represent the prototype of a poorly recognized but potentially relevant response to oxidative injury involving down-regulation of ROS-producing enzymes.

  • Jones J.M.et al., 2000, J. Biol. Chem. 275:12590-7.
  • Recalcati,S. et al., 2001, J Cell Sci. 114 (Pt 9):1625-9.
  • Recalcati,S. et al., 2003, Hepatology. 38 (5):1159-66.
  • Murray M.S.et al., 2008, Biochemistry 47:2439-49.
  • Bourhis J.M.et al., 2009, Acta Crystallogr. F 65:1246-53.
  • Size / Price
    Каталог: HG12076-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.