Быстрый заказ

Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human H2AFV Информация о продукте «Клон cDNA»
Размер кДНК:387bp
Описание кДНК:Full length Clone DNA of Homo sapiens H2A histone family, member V with N terminal Myc tag.
Синоним гена:FLJ26479, H2AV, MGC10170, MGC10831, MGC1947, H2AFV
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14327-ACGRBS15400
Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14327-ACRRBS15400
Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14327-ANGRBS15400
Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14327-ANRRBS15400
Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14327-CFRBS13340
Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14327-CHRBS13340
Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14327-CMRBS13340
Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14327-CYRBS13340
Человек H2AFV Джин клон кДНК в вектор клонированияHG14327-GRBS5130
Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14327-NFRBS13340
Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14327-NHRBS13340
Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14327-NMRBS13340
Человек H2AFV Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14327-NYRBS13340
Человек H2AFV Джин ORF экспрессии кДНК клона плазмидыHG14327-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14327-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.