After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GZMH Информация о продукте «Клон cDNA»
Размер кДНК:741bp
Описание кДНК:Full length Clone DNA of Homo sapiens granzyme H (cathepsin G-like 2, protein h-CCPX) with C terminal Flag tag.
Синоним гена:CCP-X, CGL-2, CSP-C, CTLA1, CTSGL2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10348-ACGRBS15400
Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10348-ACRRBS15400
Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10348-CFRBS13340
Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10348-CHRBS13340
Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10348-CMRBS13340
Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10348-CYRBS13340
Человек Granzyme H/GZMH Джин клон кДНК в вектор клонированияHG10348-MRBS5130
Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10348-M-FRBS13340
Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10348-NFRBS13340
Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10348-NHRBS13340
Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10348-NMRBS13340
Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10348-NYRBS13340
Человек Granzyme H/GZMH Джин ORF экспрессии кДНК клона плазмидыHG10348-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Granzymes are key components of the immune response that play important roles in eliminating host cells infected by intracellular pathogens. Several granzymes are potent inducers of cell death. A total of eight granzymes (A-G and M) have been identified in the mouse, but only five are known in humans (A, B, H, M and granzyme 3), and granzyme H appears to be specifically human. Human granzyme H is a neutral serine protease that is expressed predominantly in the lymphokine-activated killer (LAK)/natural?killer (NK) compartment of the immune system. In adenovirus-infected cells in which granzyme B (gzmB) and downstream apoptosis pathways are inhibited, granzyme H directly cleaves the adenovirus DNA-binding protein (DBP), a viral component absolutely required for viral DNA replication. This virus demonstrated that gzmH directly induces an important decay in viral DNA replication. Interestingly, gzmH also cleaves the adenovirus 100K assembly protein, a major inhibitor of gzmB, and relieves gzmB inhibition. Granzyme H has a very high amino acid identity (>90%) with many portions of the granzyme B sequence, particularly near the amino terminus of the molecule despite performing a distinct enzymic function.

Size / Price
Каталог: HG10348-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.