Granzyme B cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

Granzyme B cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Human granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Granzyme B cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

CCPI cDNA ORF Clone, Human; CGL-1 cDNA ORF Clone, Human; CGL1 cDNA ORF Clone, Human; CSP-B cDNA ORF Clone, Human; CSPB cDNA ORF Clone, Human; CTLA1 cDNA ORF Clone, Human; CTSGL1 cDNA ORF Clone, Human; HLP cDNA ORF Clone, Human; SECT cDNA ORF Clone, Human

Granzyme B Background Information

Granzyme B, also known as GZMB, is the most prominent member of the granzyme family of cell death-inducing serine proteases expressed in the granules of cytotoxic T lymphocytes (CTLs) and NK cells. Granzyme B enters the target cells depending on another membrane-binding granule protein, perforin, results in the activation of effector caspases and mitochondrial depolarization through caspase-dependent and -independent pathways, and consequently induces rapid cell apoptosis. Over 3 substrates of GZMB have been identified including the key substrate caspase-3, ICAD and Bid. GZMB is suggested to protect the host by lysing cells bearing on their surface 'nonself' antigens such as bacterial and viral infected-cells and tumor cells, and accordingly plays an essential role in immunosurveillance.
Full Name
granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
References
  • Schmid J., et al.,(1987), Induction of mRNA for a serine protease and a beta-thromboglobulin-like protein in mitogen-stimulated human leukocytes. J. Immunol. 139:250-256.
  • Caputo A., et al., (1988), Structure and differential mechanisms of regulation of expression of a serine esterase gene in activated human T lymphocytes.J. Biol. Chem. 263:6363-6369.
  • Trapani J.A., et al.,(1988), Molecular cloning of an inducible serine esterase gene from human cytotoxic lymphocytes.Proc. Natl. Acad. Sci. U.S.A. 85:6924-6928.

Granzyme B cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait