Быстрый заказ

Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GZMB Информация о продукте «Клон cDNA»
Размер кДНК:744bp
Описание кДНК:Full length Clone DNA of Homo sapiens granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) with N terminal Flag tag.
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13352-ACGRBS15400
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13352-ACRRBS15400
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13352-ANGRBS15400
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13352-ANRRBS15400
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13352-CFRBS13340
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13352-CHRBS13340
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13352-CMRBS13340
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13352-CYRBS13340
Человек Granzyme B/GZMB Джин клон кДНК в вектор клонированияHG13352-GRBS5130
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13352-G-HRBS13340
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13352-NFRBS13340
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13352-NHRBS13340
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13352-NMRBS13340
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13352-NYRBS13340
Человек Granzyme B/GZMB Джин ORF экспрессии кДНК клона плазмидыHG13352-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Granzyme B, also known as GZMB, is the most prominent member of the granzyme family of cell death-inducing serine proteases expressed in the granules of cytotoxic T lymphocytes (CTLs) and NK cells. Granzyme B enters the target cells depending on another membrane-binding granule protein, perforin, results in the activation of effector caspases and mitochondrial depolarization through caspase-dependent and -independent pathways, and consequently induces rapid cell apoptosis. Over 30 substrates of GZMB have been identified including the key substrate caspase-3, ICAD and Bid. GZMB is suggested to protect the host by lysing cells bearing on their surface 'nonself' antigens such as bacterial and viral infected-cells and tumor cells, and accordingly plays an essential role in immunosurveillance.

Size / Price
Каталог: HG13352-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.