After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human GSTZ1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC001453
Размер кДНК:651bp
Описание кДНК:Full length Clone DNA of Homo sapiens glutathione S-transferase zeta 1.
Синоним гена:GSTZ1-1, MAAI, MAI, MGC2029, GSTZ1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14237-ACGRBS15396
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14237-ACRRBS15396
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14237-ANGRBS15396
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14237-ANRRBS15396
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14237-CFRBS13343
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14237-CHRBS13343
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14237-CMRBS13343
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14237-CYRBS13343
Человек GSTZ1 Джин клон кДНК в вектор клонированияHG14237-GRBS5132
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14237-NFRBS13343
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14237-NHRBS13343
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14237-NMRBS13343
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14237-NYRBS13343
Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмидыHG14237-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

GSTZ1 gene is a member of the glutathione S-transferase (GSTs) super-family which encodes multifunctional enzymes important in the detoxification of electrophilic molecules, including carcinogens, mutagens, and several therapeutic drugs, by conjugation with glutathione. GSTZ1 is a bifunctional protein which has minimal glutathione-conjugating activity with ethacrynic acid and 7-chloro-4-nitrobenz-2-oxa-1,3-diazole and maleylacetoacetate isomerase activity. GSTZ1 catalyzes the glutathione dependent oxygenation of dichloroacetic acid to glyoxylic acid. GSTZ1 participates in the catabolism of phenylalanine and tyrosine. Thus defects in GSTZ1 cause harsh metabolic disorders including alkaptonuria, phenylketonuria and tyrosinaemia.

Ссылки
  • Tong Z. et al., 1999, Chem Res Toxicol. 11 (11): 1332-8.
  • Tong Z. et al., 1999, Biochem J. 331 (2): 371-4.
  • Ketterer B. 2001, Chem Biol Interact. 138 (1): 27-42.
  • Size / Price
    Каталог: HG14237-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».