Быстрый заказ

Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек GSTZ1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC001453
    Размер кДНК:651bp
    Описание кДНК:Full length Clone DNA of Homo sapiens glutathione S-transferase zeta 1.
    Синоним гена:GSTZ1-1, MAAI, MAI, MGC2029, GSTZ1
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GSTZ1 qPCR primers for gene expression analysis, HP102887 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14237-ACGRBS15400
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14237-ACRRBS15400
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14237-ANGRBS15400
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14237-ANRRBS15400
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14237-CFRBS13340
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14237-CHRBS13340
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14237-CMRBS13340
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14237-CYRBS13340
    Человек GSTZ1 Джин клон кДНК в вектор клонированияHG14237-GRBS5130
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14237-NFRBS13340
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14237-NHRBS13340
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14237-NMRBS13340
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14237-NYRBS13340
    Человек GSTZ1 Джин ORF экспрессии кДНК клона плазмидыHG14237-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    GSTZ1 gene is a member of the glutathione S-transferase (GSTs) super-family which encodes multifunctional enzymes important in the detoxification of electrophilic molecules, including carcinogens, mutagens, and several therapeutic drugs, by conjugation with glutathione. GSTZ1 is a bifunctional protein which has minimal glutathione-conjugating activity with ethacrynic acid and 7-chloro-4-nitrobenz-2-oxa-1,3-diazole and maleylacetoacetate isomerase activity. GSTZ1 catalyzes the glutathione dependent oxygenation of dichloroacetic acid to glyoxylic acid. GSTZ1 participates in the catabolism of phenylalanine and tyrosine. Thus defects in GSTZ1 cause harsh metabolic disorders including alkaptonuria, phenylketonuria and tyrosinaemia.

    Ссылки
  • Tong Z. et al., 1999, Chem Res Toxicol. 11 (11): 1332-8.
  • Tong Z. et al., 1999, Biochem J. 331 (2): 371-4.
  • Ketterer B. 2001, Chem Biol Interact. 138 (1): 27-42.
  • Size / Price
    Каталог: HG14237-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».