Быстрый заказ

Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human GSTT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC007065
Размер кДНК:723bp
Описание кДНК:Full length Clone DNA of Homo sapiens glutathione S-transferase theta 1.
Синоним гена:GSTT1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14246-ACGRBS15400
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14246-ACRRBS15400
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14246-ANGRBS15400
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14246-ANRRBS15400
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14246-CFRBS13340
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14246-CHRBS13340
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14246-CMRBS13340
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14246-CYRBS13340
Человек GSTT1 Джин клон кДНК в вектор клонированияHG14246-GRBS5130
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14246-NFRBS13340
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14246-NHRBS13340
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14246-NMRBS13340
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14246-NYRBS13340
Человек GSTT1 Джин ORF экспрессии кДНК клона плазмидыHG14246-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14246-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».