After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human GSTO2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC056918
Размер кДНК:732bp
Описание кДНК:Full length Clone DNA of Homo sapiens glutathione S-transferase omega 2 DNA.
Синоним гена:GSTO 2-2, bA127L20.1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15244-ACGRBS15400
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15244-ACRRBS15400
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15244-ANGRBS15400
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15244-ANRRBS15400
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15244-CFRBS13340
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15244-CHRBS13340
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15244-CMRBS13340
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15244-CYRBS13340
Человек GSTO2 Джин клон кДНК в вектор клонированияHG15244-GRBS5130
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15244-NFRBS13340
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15244-NHRBS13340
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15244-NMRBS13340
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15244-NYRBS13340
Человек GSTO2 Джин ORF экспрессии кДНК клона плазмидыHG15244-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15244-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».