After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GSTM2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000848
Размер кДНК:657bp
Описание кДНК:Full length Clone DNA of Homo sapiens glutathione S-transferase mu 2 (muscle), transcript variant 1 with C terminal His tag.
Синоним гена:GST4
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12042-ACGRBS15400
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12042-ACRRBS15400
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12042-ANGRBS15400
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12042-ANRRBS15400
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12042-CFRBS13340
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12042-CHRBS13340
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12042-CMRBS13340
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12042-CYRBS13340
Человек GSTM2 transcript variant 1 Джин клон кДНК в вектор клонированияHG12042-GRBS5130
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12042-NFRBS13340
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12042-NHRBS13340
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12042-NMRBS13340
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12042-NYRBS13340
Человек GSTM2 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG12042-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Glutathione S-transferase Mu 2, also known as GST class-mu 2, GSTM2-2 and GSTM2, is a cytoplasm protein which belongs to the GST superfamily and Mu family. GSTM2 / GST4 contains one GST C-terminal domain and one GST N-terminal domain. The glutathione S-transferases (GSTs) are a multigene family of enzymes largely involved in the detoxification of chemicals. Eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. Butyrate, an important luminal component produced from fermentation of dietary fibers, is an efficient inducer of GSTs and especially of GSTM2. Butyrate may act chemoprotectively by increasing detoxification capabilities in the colon mucosa.

Ссылки
  • Campbell E, et al.,1990, J Biol Chem 265 (16): 9188-93. 
  • Vorachek WR, et al.,1991, Proc Natl Acad Sci USA. 88 (10): 4443-7.
  • Ebert,M.N. et al., 2003, Carcinogenesis. 24 (10):1637-44.
  • Size / Price
    Каталог: HG12042-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».