GSTA4 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14287-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All GSTA4 Reagents

CRO Services

Product recommended


All GSTA4 Reagents

GSTA4 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
669 bp
Description
Full length Clone DNA of Human glutathione S-transferase alpha 4 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GSTA4 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

GSTA4-4 cDNA ORF Clone, Human;GTA4 cDNA ORF Clone, Human

GSTA4 Background Information

Full Name
glutathione S-transferase alpha 4

GSTA4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GSTA4 cDNA ORF Clone in Cloning Vector, Mouse MG53366-U
GSTA4 cDNA ORF Clone, Mouse, untagged MG53366-UT
GSTA4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53366-ACGLN
GSTA4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53366-ACG
GSTA4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53366-ANG
GSTA4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53366-ACR
GSTA4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53366-ANR
GSTA4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53366-CF
GSTA4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53366-NF
GSTA4 cDNA ORF Clone, Mouse, C-His tag MG53366-CH
GSTA4 cDNA ORF Clone, Mouse, N-His tag MG53366-NH
GSTA4 cDNA ORF Clone, Mouse, C-HA tag MG53366-CY
GSTA4 cDNA ORF Clone, Mouse, N-HA tag MG53366-NY
GSTA4 cDNA ORF Clone, Mouse, C-Myc tag MG53366-CM
GSTA4 cDNA ORF Clone, Mouse, N-Myc tag MG53366-NM

GSTA4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GSTA4 cDNA ORF Clone in Cloning Vector, Human HG14287-G
GSTA4 cDNA ORF Clone, Human, untagged HG14287-UT
GSTA4 cDNA ORF Clone, Human, C-GFPSpark® tag HG14287-ACG
GSTA4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14287-ACGLN
GSTA4 cDNA ORF Clone, Human, N-GFPSpark® tag HG14287-ANG
GSTA4 cDNA ORF Clone, Human, C-OFPSpark® tag HG14287-ACR
GSTA4 cDNA ORF Clone, Human, N-OFPSpark® tag HG14287-ANR
GSTA4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14287-CF
GSTA4 cDNA ORF Clone, Human, C-His tag HG14287-CH
GSTA4 cDNA ORF Clone, Human, N-His tag HG14287-NH
GSTA4 cDNA ORF Clone, Human, C-HA tag HG14287-CY
GSTA4 cDNA ORF Clone, Human, N-HA tag HG14287-NY
GSTA4 cDNA ORF Clone, Human, C-Myc tag HG14287-CM
GSTA4 cDNA ORF Clone, Human, N-Myc tag HG14287-NM
GSTA4 qPCR Primer Pairs, Human HP102937
info info
添加购物车成功! 添加购物车失败!