GRK4 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

GRK4 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1737 bp
Description
Full length Clone DNA of Human G protein-coupled receptor kinase 4 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GRK4 cDNA ORF Clone, Human, C-His tag: Alternative Names

GPRK2L cDNA ORF Clone, Human; GPRK4 cDNA ORF Clone, Human; GRK4a cDNA ORF Clone, Human; IT11 cDNA ORF Clone, Human

GRK4 Background Information

Full Name
G protein-coupled receptor kinase 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait