Быстрый заказ

Text Size:AAA

Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GRK4 Информация о продукте «Клон cDNA»
Размер кДНК:1737bp
Описание кДНК:Full length Clone DNA of Homo sapiens G protein-coupled receptor kinase 4 with C terminal His tag.
Синоним гена:IT11, GPRK4, GRK4a, GPRK2L
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15745-ACGRBS16764
Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15745-ACRRBS16764
Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15745-ANGRBS16764
Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15745-ANRRBS16764
Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15745-CFRBS14711
Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15745-CHRBS14711
Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15745-CMRBS14711
Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15745-CYRBS14711
Человек GRK4 Джин клон кДНК в вектор клонированияHG15745-GRBS5132
Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15745-NFRBS14711
Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15745-NHRBS14711
Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15745-NMRBS14711
Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15745-NYRBS14711
Человек GRK4 Джин ORF экспрессии кДНК клона плазмидыHG15745-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15745-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.