Быстрый заказ

Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек GRK4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC117320
    Размер кДНК:1737bp
    Описание кДНК:Full length Clone DNA of Homo sapiens G protein-coupled receptor kinase 4 with C terminal His tag.
    Синоним гена:IT11, GPRK4, GRK4a, GPRK2L
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GRK4 qPCR primers for gene expression analysis, HP104338 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15745-ACGRBS16760
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15745-ACRRBS16760
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15745-ANGRBS16760
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15745-ANRRBS16760
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15745-CFRBS14710
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15745-CHRBS14710
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15745-CMRBS14710
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15745-CYRBS14710
    Человек GRK4 Джин клон кДНК в вектор клонированияHG15745-GRBS5130
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15745-NFRBS14710
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15745-NHRBS14710
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15745-NMRBS14710
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15745-NYRBS14710
    Человек GRK4 Джин ORF экспрессии кДНК клона плазмидыHG15745-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».