After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек GRB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GRB2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002086.4
Размер кДНК:654bp
Описание кДНК:Full length Clone DNA of Homo sapiens growth factor receptor-bound protein 2 with N terminal HA tag.
Синоним гена:NCKAP2
Виды:Human
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек GRB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек GRB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12099-ACGRBS15400
Человек GRB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12099-ACRRBS15400
Человек GRB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12099-CFRBS13340
Человек GRB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12099-CHRBS13340
Человек GRB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12099-CMRBS13340
Человек GRB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12099-CYRBS13340
Человек GRB2 Джин клон кДНК в вектор клонированияHG12099-GRBS5130
Человек GRB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12099-NFRBS13340
Человек GRB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12099-NHRBS13340
Человек GRB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12099-NMRBS13340
Человек GRB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12099-NYRBS13340
Человек GRB2 Джин ORF экспрессии кДНК клона плазмидыHG12099-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».