GPRASP2 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

GPRASP2 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2517 bp
Description
Full length Clone DNA of Human G protein-coupled receptor associated sorting protein 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GPRASP2 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

GASP2 cDNA ORF Clone, Human

GPRASP2 Background Information

G proteincoupled receptorassociated sorting protein 2 (GPRASP2), a member of the GASP family, has been reported to be involved in the modulation of transcription. The Pitchfork (Pifo) and the G protein-coupled receptor associated sorting protein 2 (Gprasp2) are essential components of an Hh induced ciliary targeting complex able to regulate Smo translocation to the PC.
Full Name
G protein-coupled receptor associated sorting protein 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait