Быстрый заказ

Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек GPC6 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_005708.3
    Размер кДНК:1668bp
    Описание кДНК:Full length Clone DNA of Homo sapiens glypican 6 with N terminal His tag.
    Синоним гена:GPC6, MGC126288
    Виды:Human
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GPC6 qPCR primers for gene expression analysis, HP100182 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10102-ACGRBS16760
    Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10102-ACRRBS16760
    Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10102-CFRBS14710
    Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10102-CHRBS14710
    Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10102-CMRBS14710
    Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10102-CYRBS14710
    Человек Glypican 6/GPC6 Джин клон кДНК в вектор клонированияHG10102-MRBS5130
    Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10102-NFRBS14710
    Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10102-NHRBS14710
    Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10102-NMRBS14710
    Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10102-NYRBS14710
    Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмидыHG10102-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG10102-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».