After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GPC6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005708.3
Размер кДНК:1668bp
Описание кДНК:Full length Clone DNA of Homo sapiens glypican 6 with N terminal His tag.
Синоним гена:GPC6, MGC126288
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10102-ACGRBS16760
Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10102-ACRRBS16760
Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10102-CFRBS14710
Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10102-CHRBS14710
Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10102-CMRBS14710
Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10102-CYRBS14710
Человек Glypican 6/GPC6 Джин клон кДНК в вектор клонированияHG10102-MRBS5130
Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмидыHG10102-M-NRBS14710
Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10102-NFRBS14710
Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10102-NHRBS14710
Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10102-NMRBS14710
Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10102-NYRBS14710
Человек Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмидыHG10102-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».