Быстрый заказ

Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GP1BB Информация о продукте «Клон cDNA»
Размер кДНК:621bp
Описание кДНК:Full length Clone DNA of Homo sapiens glycoprotein Ib (platelet), beta polypeptide with N terminal His tag.
Синоним гена:CD42c, GP1BB
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10742-ACGRBS15400
Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10742-ACRRBS15400
Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10742-CFRBS13340
Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10742-CHRBS13340
Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10742-CMRBS13340
Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10742-CYRBS13340
Человек GP1BB/CD42c Джин клон кДНК в вектор клонированияHG10742-MRBS5130
Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10742-M-FRBS13340
Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10742-NFRBS13340
Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10742-NHRBS13340
Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10742-NMRBS13340
Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10742-NYRBS13340
Человек GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмидыHG10742-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Platelet glycoprotein Ib (GPIb) complex is best known as a major platelet receptor for von Willebrand factor essential for platelet adhesion under high shear conditions found in arteries and in thrombosis. The GPIb complex is composed of GPIb alpha (Platelet glycoprotein Ib alpha chain) covalently attached to GPIb beta (Platelet glycoprotein Ib beta chain) and noncovalently complexed with GPIX and GPV. GPIb-beta, also known as GP1BB, CD42b-beta and CD42c, is single-pass type I membrane protein expressed in heart and brain, which is a critical component of the von Willebrand factor (vWF) receptor. The cysteine knot region of GPIb beta in the N terminus is critical for the conformation of GPIb beta that interacts with GPIX. The precursor of GP1BB is synthesized from a 1.0 kb mRNA expressed in plateletes and megakaryocytes. GPIb is a heterodimeric transmembrane protein consisting of a disulfide-linked 140 kD alpha chain and 22 kD beta chain. GPIb alpha chain provides the vWF binding site, and GPIb beta chain contributes to surface expression of the receptor and participates in transmembrane signaling through phosphorylation of its intracellular domain. GP1BB is part of the GPIb-V-IX system that constitutes the receptor for von Willebrand factor (vWF), and mediates platelet adhesion in the arterial circulation. Defects in GP1BB are a cause of Bernard-Soulier syndrome (BSS), also known as giant platelet disease (GPD). BSS patients have unusually large platelets and have a clinical bleeding tendency.

  • Kenny D, et al. (2002) The cysteine knot of platelet glycoprotein Ib beta (GPIb beta) is critical for the interaction of GPIb beta with GPIX. Blood. 99(12): 4428-33.
  • Tang J,et al. (2004) Mutation in the leucine-rich repeat C-flanking region of platelet glycoprotein Ib beta impairs assembly of von Willebrand factor receptor. Thromb Haemost. 92(1): 75-88.
  • Vanhoorelbeke K, et al. (2007) Inhibition of platelet glycoprotein Ib and its antithrombotic potential. Curr Pharm Des. 13(26): 2684-97.
  • Clemetson KJ, et al. (2008) Platelet GPIb complex as a target for anti-thrombotic drug development. Thromb Haemost. 99(3): 473-9.
  • Size / Price
    Каталог: HG10742-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.