Aspartate Aminotransferase cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

Aspartate Aminotransferase cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1242 bp
Description
Full length Clone DNA of Human glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Aspartate Aminotransferase cDNA ORF Clone, Human, N-HA tag: Alternative Names

ASTQTL1 cDNA ORF Clone, Human; cAspAT cDNA ORF Clone, Human; cCAT cDNA ORF Clone, Human; GIG18 cDNA ORF Clone, Human

Aspartate Aminotransferase Background Information

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.
Full Name
glutamic-oxaloacetic transaminase 1, soluble
References
  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
Add to Cart Successfully Add to Cart Failed