After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GOPC Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC009553
Размер кДНК:1365bp
Описание кДНК:Full length Clone DNA of Homo sapiens golgi-associated PDZ and coiled-coil motif containing with N terminal Myc tag.
Синоним гена:CAL, FIG, PIST, GOPC1, dJ94G16.2
Виды:Human
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14911-ACGRBS15400
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14911-ACRRBS15400
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14911-ANGRBS15400
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14911-ANRRBS15400
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14911-CFRBS13340
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14911-CHRBS13340
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14911-CMRBS13340
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14911-CYRBS13340
Человек GOPC / PIST Джин клон кДНК в вектор клонированияHG14911-GRBS5130
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14911-NFRBS13340
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14911-NHRBS13340
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14911-NMRBS13340
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14911-NYRBS13340
Человек GOPC / PIST Джин ORF экспрессии кДНК клона плазмидыHG14911-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

GOPC, also known as PIST, interacts specifically with TC10 (a Rho-family small GTPase)] as a binding partner for Rhotekin. Rhotekin associates with PIST in vitro and in both polarized and non-polarized MDCK (Madin-Darby canine kidney) cells. The C-terminal SPV (Ser-Pro-Val) motif of Rhotekin binds to the PDZ domain of PIST. The co-localization of PIST and Rhotekin at the Golgi apparatus can be detected in non-polarized fibroblast-like MDCK cells and AJs (adherens junctions) in the fully polarized cells. PIST and Rhotekin are recruited from the cytosol to AJs as the cell becomes polarized. Expression of constitutively active Rho or prevention of Rhotekin-PIST interaction induced diffuse cytoplasmic distribution of Rhotekin in polarized MDCK cells. GOPC may regulate CFTR chloride currents and acid-induced ACCN3 currents by modulating cell surface expression of both channels. It may also regulate the intracellular trafficking of the ADR1B receptor. GOPC is ubiquitously expressed and its overexpression results in CFTR intracellular retention and degradation in the lysosomes.

Ссылки
  • Hicks SW. et al., 2005, J Biol Chem. 280 (32): 28944-51.
  • Ito H. et al., 2006, Biochem J Aug. 397 (3): 389-98.
  • Amin N. et al., 2012, Mol Psychiatry. 17 (11): 1116-29.
  • Size / Price
    Каталог: HG14911-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».