After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GNGT1 Информация о продукте «Клон cDNA»
Размер кДНК:225bp
Описание кДНК:Full length Clone DNA of Homo sapiens guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 with N terminal His tag.
Синоним гена:GNG1, GNGT1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13658-ACGRBS15400
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13658-ACRRBS15400
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13658-ANGRBS15400
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13658-ANRRBS15400
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13658-CFRBS13340
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13658-CHRBS13340
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13658-CMRBS13340
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13658-CYRBS13340
Человек GNGT1 Джин клон кДНК в вектор клонированияHG13658-GRBS5130
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13658-NFRBS13340
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13658-NHRBS13340
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13658-NMRBS13340
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13658-NYRBS13340
Человек GNGT1 Джин ORF экспрессии кДНК клона плазмидыHG13658-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

GNGT1 is a subunit of of transducin. Heterotrimeric G proteins consist of alpha, beta, and gamma subunits. They are membrane bound GTPases that are linked to 7-TM receptors. They function as signal transducers for the 7-transmembrane-helix G protein-coupled receptors. They are involved as a modulator or transducer in various transmembrane signaling systems. G proteins are bound to GDP in the 'off' state. GNGT1 is the gamma subunit of transducin. Ligand-receptor binding results in detachment of the G protein, switching it to an 'on' state and permitting Galpha activation of second messenger signalling cascades. There are several types of Galpha proteins; in addition, some Gbetagamma subunits have active functions. Gbetagamma coupled to H1 receptors can activate PLA2 and Gbetagamma coupled to M1 receptors can activate KIR channels. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction.

  • Tao L, et al. (1993) Structure of the bovine transducin gamma subunit gene and analysis of promoter function in transgenic mice. Exp Eye Res. 56 (4): 497-507.
  • Yan K, et al. (1996) Differential ability to form the G protein betagamma complex among members of the beta and gamma subunit families. J Biol Chem. 271 (12): 7141-6.
  • Gaudet R, et al. (1999) A molecular mechanism for the phosphorylation-dependent regulation of heterotrimeric G proteins by phosducin. Mol Cell. 3 (5): 649-60.
  • Size / Price
    Каталог: HG13658-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.