Быстрый заказ

Text Size:AAA

Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GNAI3 Информация о продукте «Клон cDNA»
Размер кДНК:1065bp
Описание кДНК:Full length Clone DNA of Homo sapiens guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 with C terminal HA tag.
Синоним гена:87U6, ARCND1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16381-ACGRBS15400
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16381-ACRRBS15400
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16381-ANGRBS15400
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16381-ANRRBS15400
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16381-CFRBS13340
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16381-CHRBS13340
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16381-CMRBS13340
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16381-CYRBS13340
Человек GNAI3 Джин клон кДНК в вектор клонированияHG16381-GRBS5130
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16381-NFRBS13340
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16381-NHRBS13340
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16381-NMRBS13340
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16381-NYRBS13340
Человек GNAI3 Джин ORF экспрессии кДНК клона плазмидыHG16381-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16381-CY
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • other Green fluorescent protein / GFP Gene Plasmid Map 5612
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.